NCBI BLAST Extra Exercises Part 2: Comparing Sequences

Open Standard Nucleotide BLAST

in another browser window to work through this tutorial side by side.

Comparing Sequences

1 of 7
Now let's compare the two sequences we looked at in Part 1 to find the similarities.

Enter the first (fungus) sequence in the "Enter Query Sequence" box:

>Seq1
ATGGGTAAGGAGGACAAGACTCACCTTAACGT
CGTCGTCATCGGCCACGTCGACTCTGGCAAGT
CGACCACTGTAAGTACAACCAACAGCGGGTTG
CTTATCTGCACTCGGAATCCGCCAAACCTGGC
AGGGTATCACCAAAACATCTTGCTAACTTTTG
ACAGACCGGTCACTTGATCTACCAGTGCGGTG
GTATCGACAAGCGAACCATCGAGAAGTTCGAG
AAGGTTAGTCAATATCCCTTCGATTACGCGCG
CTCCCATCGATTCCCACGATTCGCTCCCTCAC
TCGAAACACATCCATTACCCCGCTCGAGTCCG
AAAATTTTGCGGTGCGACCGTGATTTTTTCTG
GTGGGGTATCTTACCCCGCCACTCGAGTCACG
GATGCGCTTGCCCTGTTCCCACAAAACCTTAC
CACCCTGTCGCGCACTACATGTCTTGCAGTCA
CTAACCACTGGACAATAGGAAGCCGCCGAGCT
CGGAAAGGGTTCCTTCAAGTACGCCTGGGTTC
TTGACAAGCTCAAAGCCGAGCGTGAGCGTGGT
ATCACCATTGATATCGCTCTCTGGAAGTTCGA
GACTCCTCGCTACTATGTCACCGTCATTGGTA
TGTTGTCACCGTCTCACACTATCATGTATTCA
TCATGCTAACATCTCTCTCAGATGCCCCCGGT
CATCGTGATTTCATCAAGAACATGATC

Comparing Sequences

2 of 7

Select "Align two or more sequences," 

comparing 2 sequences

and enter the second (cattle) sequence in the "Enter Subject Sequence" box:

>Seq2

ATGGGAAAGGAGAAGACCCACATCAACATCGTTGT
CATTGGGCACGTAGATTCAGGGAAGTCTACCACGA
CTGGCCATCTGATCTATAAATGTGGCGGGATCGAC
AAGAGAACAATTGAAAAGTTCGAGAAGGAGGCTGC
CGAGATGGGAAAGGGCTCCTTCAAATATGCCTGGG
TCTTGGACAAACTTAAAGCTGAACGTGAGCGTGGT
ATCACCATTGATATCTCCCTGTGGAAATTTGAGAC
CAGCAAGTACTATGTTACCATCATTGATGCCCCAG
GACACAGAGACTTCATCAAAAACATGATTACAGGC
ACATCCCAGGCTGACTGTGCTGTCCTGATCGTTGC
TGCTGGTGTTGGTGAATTTGAAGCCGGTATCTCCA
AGAACGGGCAGACCCGTGAGCATGCCCTTTTGGCT
TACACCCTGGGTGTGAAACAACTAATTGTTGGCGT
TAACAAAATGGATTCCACTGAGCCACCCTATAGCC
AGAAGAGATACGAAGAAATTGTTAAGGAAGTCAGC
ACCTATATTAAGAAAATTGGCTACAACCCCGACAC
AGTAGCATTTGTGCCAATTTCTGGCTGGAATGGTG
ACAACATGCTAGAACCAAGTGCTAATATGCCATGG
TTCAAGGGATGGAAAGTCACCCGTAAGGACGGCAA
TGCCAGTGGAACCACCCTGCTTGAAGCTCTGGATT
GCATTCTGCCACCAACTCGCCCAACTGACAAACCC
TTGCGTTTGCCTCTCCAGGATGTCTATAAAATTGG
TGGTATTGGTACTGTCCCTGTGGGTCGTGTGGAGA
CTGGTGTTCTCAAACCTGGCATGGTGGTCACCTTT
GCTCCAGTCAATGTAACAACTGAAGTGAAGTCTGT
AGAAATGCACCATGAAGCATTGAGTGAAGCCCTTC
CTGGGGACAATGTGGGCTTTAATGTCAAAAACGTG
TCTGTCAAAGATGTCCGTCGTGGCAATGTGGCTGG
TGACAGCAAAAATGATCCACCCATGGAAGCTGCTG
GCTTCACAGCTCAGGTGATTATTTTGAACCATCCA
GGCCAAATCAGTGCTGGATATGCACCTGTGCTGGA
TTGTCACACAGCTCACATTGCTTGCAAGTTTGCTG
AGCTGAAGGAGAAGATTGATCGTCGTTCTGGGAAA
AAGCTGGAAGATGGCCCTAAATTCTTGAAATCTGG
TGACGCTGCCATCGTTGATATGGTTCCTGGCAAGC
CCATGTGTGTCGAGAGCTTCTCTGATTATCCTCCC
CTGGGCCGTTTTGCTGTGCGTGACATGAGACAGAC
AGTCGCTGTGGGTGTCATCAAAGCAGTGGACAAGA
AGGCAGCTGGAGCTGGCAAGGTCACCAAGTCTGCC
CAGAAAGCTCAGAAGGCTAAATGA

Comparing Sequences

3 of 7

Note the default setting for Program Selection is "Highly similar sequences (megablast).

megablast

Leave this setting at megablast, and click the BLAST button at the bottom.

BLAST button

Comparing Sequences

4 of 7

You might be disappointed to see that no significant similarity between these two sequences was found.

no similarity

When this happens you can try a more sensitive algorithm.

Use the Edit Search button at the top to return to the BLASTn screen.

Edit search

Comparing Sequences

5 of 7

This time, under "Program Selection," choose the option for "more dissimilar sequences."

more dissimilar sequences

Then try BLAST again.

Comparing Sequences

6 of 7

Once you are on the results screen, click the Alignments tab to see how these sequences match up.

alignments tab

To see the alignments more easily and view the coding differences, select the Alignment view as "Pairwise with dots for identities" and check the CDS feature box.

Pairwise with dots

The results show that the two sequences align in three different places or ranges. The three ranges are sorted by E value. In other words, they are shown in the order of similarity.

3 alignments

You can study these sequences to see the similarities and differences.

Comparing Sequences

7 of 7

You have reached the end of this extra exercise on BLAST.

Close both windows to end the Guide.

Powered by Guide on the Side from the University of Arizona Libraries
Developed resources reported in this site are supported by the National Library of Medicine (NLM), National Institutes of Health (NIH) under cooperative agreement number UG4LM012344 with the University of Utah Spencer S. Eccles Health Sciences Library. The content is solely the responsibility of the authors and does not necessarily represent the official views of NIH..