NCBI BLAST (Part 1): Identifying Sequences

Open https://ncbi.nlm.nih.gov

in another browser window to work through this tutorial side by side.

Introduction: BLAST

1 of 2
NCBI BLAST allows you to input a sequence from DNA, RNA or protein residues (amino acids) and find sequences that are identical or similar.

To get to BLAST from the NCBI home page, click BLAST from the Popular Resources menu bar on the right of the page.

NCBI home page

[Click on image above to expand]

You can also get to BLAST directly by going to http://blast.ncbi.nlm.nih.gov/

Introduction: BLAST

2 of 2

For this simple exercise we will give you a nucleotide sequence to identify. Click Nucleotide BLAST on the left of the page.

Link to Nucleotide BLAST

Identifying Sequences with BLAST

1 of 3

There are many options on the Standard Nucleotide BLAST page. For example, you can select different databases to search; you can exclude certain data sources; and you can select a specific algorithm by which to search.

For your first BLAST, we will keep this very basic. We will mostly use the default options to enter a sequence string, and we'll use BLAST to identify the organism it came from, and see what else we can learn about it.

Identifying Sequences with BLAST

2 of 3

Copy and paste the entire string of nucleotide symbols, below, into the box under Enter Query Sequence.

Copy this:

ATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTA

CTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGATC

ACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCC

TGTATGCCCTTTTCCTAACACTCACAACAAAACTAACTA

ATACTAACATCTCAGACGCTCAGGAAATAGAAACCGTC

TGAACTATCCTGCCCGCCATCATCCTAGTCCTCATCGC

CCTCCCATCCCTACGCATCCTTTACATAACAGACGAGG

TCAACGATCCCTCCCTTACCATCAAATCAATTGGCCAC

CAATGGTACTGAACCTACGAGTACACCGACTACGGCG

GACTAATCTTCAACTCCTACATACTTCCCCCATTATTC

CTAGAACCAGGCGACCTGCGACTCCTTGACGTTGACA

ATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGTATA

ATAATTACATCACAAGACGTCTTGCACTCATGAGCTGT

CCCCACATTAGGCTTAAAAACAGATGCAATTCCCGGAC

GTCTAAACCAAACCACTTTCACCGCTACACGACCGGGG

GTATACTACGGTCAATGCTCTGAAATCTGTGGAGCAAA

CCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCCT

AAAAATCTTTGAAATAGGGCCCGTATTTACCCTATAG

to here:

standard blast page

Uncheck this box labeled "Align two more sequences" if it is checked:

A screenshot showing the "Align two or more sequences" checkbox.

then scroll down and click the BLAST button:

BLAST button

 

Identifying Sequences with BLAST

3 of 3

You may need to be patient.

BLAST is crunching a huge amount of data.

You will see a screen like this for a while during processing:

processing screen

Reading your BLAST Results

1 of 2

Once your results are displayed, you will see a header followed by the results of your search. The results can be displayed in several different views, including a list of sequence "Descriptions," via a "Graphic Summary," and via a more detailed "Alignments" view.

Select the Graphic Summary by clicking on this tab:

A screenshot of a BLAST results page, indicating the "Graphic Summary" tab.

to see a graphic summary of the top 100 results.

graphic summary of results

Reading your BLAST Results

2 of 2

Each bar in this graph represents a match with another sequence in the database. The color of each line represents the extent to which the sequence in the database aligns with the sequence you input (the "Query" sequence). See the color key:

color key

Of the top 100 results for this BLAST, how many sequences in the database align very well with yours?

What are these highly aligned sequences? Where did they come from?

One way to find out is to click on one of the bars in the graphic summary. Try that now.

first BLAST result

What species is your query sequence from?

When you're ready, move on to NCBI BLAST (Part 1): Exploring your BLAST Results.

Powered by Guide on the Side from the University of Arizona Libraries
Developed resources reported in this site are supported by the National Library of Medicine (NLM), National Institutes of Health (NIH) under cooperative agreement number UG4LM012344 with the University of Utah Spencer S. Eccles Health Sciences Library. The content is solely the responsibility of the authors and does not necessarily represent the official views of NIH..